| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.154173 |
| Chromosome: | chromosome 15 |
| Location: | 442974 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g636400 | (1 of 2) K13989 - Derlin-2/3 (DERL2_3) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTTCTTCTTCGGAAATTTAGGTGCGTGC |
| Internal bar code: | CTAAGCCTGCGATGGCGGCCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 567 |
| LEAP-Seq percent confirming: | 48.506 |
| LEAP-Seq n confirming: | 8620 |
| LEAP-Seq n nonconfirming: | 9151 |
| LEAP-Seq n unique pos: | 62 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGTCGGTAAGCGCACTGAT |
| Suggested primer 2: | TTGGTATCTGCAAACCCTCC |