Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.154228 |
Chromosome: | chromosome 17 |
Location: | 5750730 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g739150 | CTPA5,TSP5 | (1 of 8) 3.4.21.102 - C-terminal processing peptidase / Tsp protease; putative C-terminal peptidase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGGCGAGGTATGCACTGAAAACCGCGAG |
Internal bar code: | CGGCGTCTTCGTGTCGGGCGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 0 |
LEAP-Seq percent confirming: | 15.9218 |
LEAP-Seq n confirming: | 1425 |
LEAP-Seq n nonconfirming: | 7525 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACGGAAAGAACGGATTGAT |
Suggested primer 2: | TGTGTGCATATGTGTGTGCC |