Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.154320 |
Chromosome: | chromosome 11 |
Location: | 1074868 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467675 | (1 of 6) PF12796//PF13920 - Ankyrin repeats (3 copies) (Ank_2) // Zinc finger, C3HC4 type (RING finger) (zf-C3HC4_3) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCGCTCATGTTCCTGTTTGGCGGCGAGG |
Internal bar code: | CCCTTGCACCGGTTCGAGGGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 450 |
LEAP-Seq percent confirming: | 7.36337 |
LEAP-Seq n confirming: | 384 |
LEAP-Seq n nonconfirming: | 4831 |
LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTTGTTTGTGTGTGGGTGC |
Suggested primer 2: | CACCCCTACTTAGCACGCTC |