Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.154610 |
Chromosome: | chromosome 6 |
Location: | 6470891 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g292900 | (1 of 10) PTHR12270:SF6 - GLYCOSYLTRANSFERASE-LIKE PROTEIN LARGE | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAACCCCCAACCCCCAACGCGTTCACTC |
Internal bar code: | GTGTAAGCGTACGCTGAACAGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 578 |
LEAP-Seq percent confirming: | 66.6667 |
LEAP-Seq n confirming: | 122 |
LEAP-Seq n nonconfirming: | 61 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCGCCTACACATCCACTTC |
Suggested primer 2: | TACACCAAGACCCAGCATGA |