Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.154659 |
Chromosome: | chromosome 9 |
Location: | 7664999 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g415400 | (1 of 1) PF08314 - Secretory pathway protein Sec39 (Sec39) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCTCAGGCTGACAGCACGGCCAGTCCCA |
Internal bar code: | AACGGGGCAAACCGACGACGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 602 |
LEAP-Seq percent confirming: | 99.5881 |
LEAP-Seq n confirming: | 8462 |
LEAP-Seq n nonconfirming: | 35 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTCCCCACCCCAGTTAGA |
Suggested primer 2: | CTGCTCCTGCTCTGTAGGCT |