| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.154661 |
| Chromosome: | chromosome 9 |
| Location: | 6233214 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g406250 | (1 of 1) IPR002893//IPR008930 - Zinc finger, MYND-type // Terpenoid cyclases/protein prenyltransferase alpha-alpha toroid | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCAGGGTCCCAGGCCCCGACGGCAATTA |
| Internal bar code: | ACGGAGCACACGTTGCCTGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 685 |
| LEAP-Seq percent confirming: | 98.8991 |
| LEAP-Seq n confirming: | 539 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGCCCTTACTTGTGGACTC |
| Suggested primer 2: | TGGTTGACAGGACACACGAT |