Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.154709 |
Chromosome: | chromosome 2 |
Location: | 6339830 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g115250 | POC1 | Proteome of centriole protein 1; (1 of 1) K16482 - centriolar protein POC1 (POC1) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCAGATGTACGACACGATGCAACAGTACA |
Internal bar code: | TTCTAGGACGCGAGCTGATCAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 816 |
LEAP-Seq percent confirming: | 95.6129 |
LEAP-Seq n confirming: | 741 |
LEAP-Seq n nonconfirming: | 34 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTTTGGAGGACTACACGGG |
Suggested primer 2: | GTCCTTTGCTGCTGGACTTC |