| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.154849 |
| Chromosome: | chromosome 2 |
| Location: | 2104467 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g089200 | HLM4,SET3 | (1 of 1) PTHR22884//PTHR22884:SF370 - SET DOMAIN PROTEINS // HISTONE-LYSINE N-METHYLTRANSFERASE, H3 LYSINE-9 SPECIFIC SUVH5-RELATED; Histone-lysine N-methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTATACTTAACCACTCTGTCATTCACAC |
| Internal bar code: | AATCCGTTTCGGTGCCTGCAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 187 |
| LEAP-Seq percent confirming: | 99.3915 |
| LEAP-Seq n confirming: | 1470 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACACACACACACGCAC |
| Suggested primer 2: | CCACACCTCTCCACACCTCT |