| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.154865 |
| Chromosome: | chromosome 7 |
| Location: | 3721407 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g337750 | EBM5 | (1 of 3) PTHR31451//PTHR31451:SF1 - FAMILY NOT NAMED // MANNAN ENDO-1,4-BETA-MANNOSIDASE 2-RELATED; Mannan endo-1%252C4-beta-mannosidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATACAACACATACAACACTGCTTGAGCTAG |
| Internal bar code: | GTCGCATACCGTGCAACCATCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 636 |
| LEAP-Seq percent confirming: | 95.24 |
| LEAP-Seq n confirming: | 14606 |
| LEAP-Seq n nonconfirming: | 730 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGACACACGCAACACAGT |
| Suggested primer 2: | CTGCATACCGAGCACTTTGA |