Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.154889 |
Chromosome: | chromosome 10 |
Location: | 1230903 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g426600 | CYP739A6,CYP27 | Cytochrome P450, CYP213 superfamily; (1 of 8) PTHR24286//PTHR24286:SF77 - FAMILY NOT NAMED // ABSCISIC ACID 8'-HYDROXYLASE 4 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGGCCCTTGCAAATTACCCGCTAAGCCGT |
Internal bar code: | AACTTGATGAATGTGCCTATAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 154 |
LEAP-Seq percent confirming: | 99.6212 |
LEAP-Seq n confirming: | 526 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGACATGCCGTTACAATGA |
Suggested primer 2: | CAGAGCCATACAGCCAGACA |