| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.154945 |
| Chromosome: | chromosome 9 |
| Location: | 1610552 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g397350 | RAD3A,XPD3 | (1 of 1) K15362 - fanconi anemia group J protein (BRIP1, BACH1, FANCJ); RAD3/XP-D family DNA-binding helicase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCTCCAGGTGCGGCTGAAGAAGGAGTAC |
| Internal bar code: | TTGCACACGAGTGTCCGACAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 512 |
| LEAP-Seq percent confirming: | 99.8618 |
| LEAP-Seq n confirming: | 1445 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATTGCATCGCAGGTCAGAG |
| Suggested primer 2: | ACACACACACATCCTCGCAT |