| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.154974 |
| Chromosome: | chromosome 14 |
| Location: | 1110657 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g615100 | MSR1,MSRB1B | (1 of 3) K07305 - peptide-methionine (R)-S-oxide reductase (msrB); Methionine sulphoxide reductase 1B | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTAACCCCCACCGCACCCCACCCCACACA |
| Internal bar code: | GGTGAAGTCCAGGTTGGCTTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 699 |
| LEAP-Seq percent confirming: | 99.9421 |
| LEAP-Seq n confirming: | 1725 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGGTCCTAGTCCTGGTCA |
| Suggested primer 2: | ATACGCACTTCCTGTGGTCC |