| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.155059 |
| Chromosome: | chromosome 9 |
| Location: | 7497115 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g413900 | GT90F18,GT90-18 | (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90); GT90 family protein 18 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTACGCCCCTTGCATGCACCTGGCTACG |
| Internal bar code: | CCCAGGTGGACGACCCTAAGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 433 |
| LEAP-Seq percent confirming: | 97.7714 |
| LEAP-Seq n confirming: | 1711 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTATGATGCGCTCGATTTGA |
| Suggested primer 2: | AGACTTTTGCGCGAGTTGTT |