| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.155093 |
| Chromosome: | chromosome 7 |
| Location: | 4092203 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g340600 | MCP21 | Mitochondrial substrate carrier protein; (1 of 2) IPR000104//IPR018108//IPR023395 - Antifreeze protein, type I // Mitochondrial substrate/solute carrier // Mitochondrial carrier domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTCACACATCCCTTCCTGGCACAACGGT |
| Internal bar code: | GGCCTGAGCAATCTGCCTAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 199 |
| LEAP-Seq percent confirming: | 99.7121 |
| LEAP-Seq n confirming: | 2424 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATATACGGCGTGCATTGTC |
| Suggested primer 2: | GTGGAAGCTGTGGCTTTAGG |