Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.155541 |
Chromosome: | chromosome 4 |
Location: | 3757859 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g229494 | (1 of 70) 3.1.3.16 - Protein-serine/threonine phosphatase / Serine/threonine specific protein phosphatase | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAAAAGCCGTCGCCGGGCCGTTAGGGGCC |
Internal bar code: | AGCTGGGCAAGCCCGGCTTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 637 |
LEAP-Seq percent confirming: | 99.2053 |
LEAP-Seq n confirming: | 749 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCATGCTCCTGATCTTCCC |
Suggested primer 2: | GAGAACACAGGAGGAGTCGC |