| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.155567 |
| Chromosome: | chromosome 2 |
| Location: | 2724623 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g093700 | (1 of 1) K14951 - cation-transporting ATPase 13A3/4/5 (ATP13A3_4_5) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCTGGTATCTACAACCCTCTCCCCCCGC |
| Internal bar code: | TAAGTGGGTAGATCCCGACGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1086 |
| LEAP-Seq percent confirming: | 93.6376 |
| LEAP-Seq n confirming: | 5416 |
| LEAP-Seq n nonconfirming: | 368 |
| LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTGGGTTGCTGTTCCTTGT |
| Suggested primer 2: | TCTCCACGTATCACGGACAA |