| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.155726 |
| Chromosome: | chromosome 12 |
| Location: | 7106540 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g559300 | ARM1 | (1 of 1) PTHR21356//PTHR21356:SF1 - ARMADILLO REPEAT CONTAINING 2 // SUBFAMILY NOT NAMED; Predicted protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCACAGTTTACCCCCATGACCGGCTACAC |
| Internal bar code: | ACAGTGGAAGAGATACCGCAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 627 |
| LEAP-Seq percent confirming: | 98.4848 |
| LEAP-Seq n confirming: | 2275 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCGTGTGGACACTAATCCC |
| Suggested primer 2: | ACTCTGCAAACCCCACAAAC |