| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.155778 |
| Chromosome: | chromosome 2 |
| Location: | 7443794 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g144350 | RJL1 | Small Rab-related GTPase; (1 of 1) K19372 - DnaJ homolog subfamily C member 27 (DNAJC27) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACATGCGCTCTGCTGTTGACGTCCCCCTCC |
| Internal bar code: | CCAATGTACTGATCTAGGGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 919 |
| LEAP-Seq percent confirming: | 96.4432 |
| LEAP-Seq n confirming: | 705 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGATGAGGTTGTGTGAGGG |
| Suggested primer 2: | TTTTGCCTGGTAGCTTGCTT |