Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.155822 |
Chromosome: | chromosome 12 |
Location: | 5107659 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g526850 | HEL56 | (1 of 1) K14810 - ATP-dependent RNA helicase DDX56/DBP9 [EC:3.6.4.13] (DDX56, DBP9); DEAD box ATP-dependent RNA helicase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGACGTTGAACTTGGGCACCGGCGCCGGC |
Internal bar code: | AGGTCCACAGGGGGAAGGCAGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 248 |
LEAP-Seq percent confirming: | 18.5222 |
LEAP-Seq n confirming: | 188 |
LEAP-Seq n nonconfirming: | 827 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAGGCTGCAGAGGTCATCCT |
Suggested primer 2: | GCGGCTGAAGGAGTACTTTG |