| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.155836 |
| Chromosome: | chromosome 3 |
| Location: | 6304983 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g193300 | CPLD56 | (1 of 1) PTHR18901//PTHR18901:SF4 - 2-DEOXYGLUCOSE-6-PHOSPHATE PHOSPHATASE 2 // SUBFAMILY NOT NAMED; haloacid dehalogenase-like hydrolase family protein | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACCGCGTCAAACCACGGTCGCTTTCTAGC |
| Internal bar code: | GGTGTCGATCGAAGAACGGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 963 |
| LEAP-Seq percent confirming: | 98.231 |
| LEAP-Seq n confirming: | 4831 |
| LEAP-Seq n nonconfirming: | 87 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCACGAGAGATCCACGTAT |
| Suggested primer 2: | CGATTCCATACACGCACATC |