| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.155953 |
| Chromosome: | chromosome 13 |
| Location: | 1946506 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g576350 | PFP2 | Prefoldin-family protein; (1 of 1) K17560 - unconventional prefoldin RPB5 interactor 1 (URI1) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCATCGCAGCACGCGCACTGGGCGCGCG |
| Internal bar code: | CGGTAAGCATGTCGCCCCCTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 509 |
| LEAP-Seq percent confirming: | 99.4152 |
| LEAP-Seq n confirming: | 170 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTTTCGTCTGTGTGACCC |
| Suggested primer 2: | GCGAATCTCCATAAACCCCT |