| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.155958 |
| Chromosome: | chromosome 6 |
| Location: | 8424946 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g307100 | AKC2 | (1 of 2) PTHR10566//PTHR10566:SF72 - CHAPERONE-ACTIVITY OF BC1 COMPLEX CABC1 -RELATED // PROTEIN KINASE FAMILY PROTEIN; conserved protein related to ABC1/COQ8 putative ser/thr kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCGACCGATGCCTAACAGCAATGAGGGT |
| Internal bar code: | AGGCCTATGGGATGGGCTATTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 953 |
| LEAP-Seq percent confirming: | 97.3607 |
| LEAP-Seq n confirming: | 13944 |
| LEAP-Seq n nonconfirming: | 378 |
| LEAP-Seq n unique pos: | 92 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGCTCGTAGGTTACAGGC |
| Suggested primer 2: | GTCTCGGTCACAGTTGAGCA |