| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.156183 |
| Chromosome: | chromosome 13 |
| Location: | 443439 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g564800 | CYG57,CYG67 | Adenylate/guanylate cyclase, nitric oxide sensing; (1 of 5) K12319 - guanylate cyclase soluble subunit beta (GUCY1B) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTGTTGTGCGTGGGGTGTACGGCGACGG |
| Internal bar code: | GTGGAGACAGCGAAAAAGCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 476 |
| LEAP-Seq percent confirming: | 97.7763 |
| LEAP-Seq n confirming: | 1495 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTAACGGGATGGAGATCA |
| Suggested primer 2: | GGTCAATGAACAACAGCCCT |