| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.156237 |
| Chromosome: | chromosome 1 |
| Location: | 3932145 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g025650 | (1 of 1) IPR013286 - Annexin, type VII | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCACCCGTCGTGGGCATTTGTCTTCGTG |
| Internal bar code: | TGTGCTGCTTGACTATATTCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1154 |
| LEAP-Seq percent confirming: | 99.5207 |
| LEAP-Seq n confirming: | 13080 |
| LEAP-Seq n nonconfirming: | 63 |
| LEAP-Seq n unique pos: | 88 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGTCTGTGGCGTTGTTAGT |
| Suggested primer 2: | CTTCGTGACTCCCGTCTAGC |