| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.156318 |
| Chromosome: | chromosome 16 |
| Location: | 1145330 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g650200 | MCP17,MITC17 | (1 of 2) K15115 - solute carrier family 25 (mitochondrial folate transporter), member 32 (SLC25A32, MFT); Mitochondrial substrate carrier protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCCAGCCTCTCTTGCCAGGATTGCGGCG |
| Internal bar code: | CTCTTTATCGGTGAGAGCTTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 506 |
| LEAP-Seq percent confirming: | 99.6436 |
| LEAP-Seq n confirming: | 3355 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGCTTAGGTGTAACGGGA |
| Suggested primer 2: | AGCTTCCGGCATCTTCTACA |