| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.156337 |
| Chromosome: | chromosome 5 |
| Location: | 2259335 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g234664 | (1 of 2) 4.2.1.93 - ATP-dependent NAD(P)H-hydrate dehydratase / ATP-dependent H(4)NAD(P)OH dehydratase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGACGTGCCCGGTGTGCGCCAGCAGGACC |
| Internal bar code: | GTTACGGTCCACTGCCTTGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1077 |
| LEAP-Seq percent confirming: | 99.9306 |
| LEAP-Seq n confirming: | 1439 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGGTTTGCCTCACTTCAT |
| Suggested primer 2: | CACACGACGTCATCATAGGG |