| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.156346 |
| Chromosome: | chromosome 7 |
| Location: | 2658151 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g330650 | (1 of 10) PF02536 - mTERF (mTERF) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCGGGTGGCAGCCAGGCGGGTAAGGGCAT |
| Internal bar code: | TCCGGCTGACAGCACTAGGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 537 |
| LEAP-Seq percent confirming: | 99.8221 |
| LEAP-Seq n confirming: | 1122 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCGATTTAGGAAAGAGACG |
| Suggested primer 2: | ACCATGCGCAAACAATAACA |