| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.156631 |
| Chromosome: | chromosome 16 |
| Location: | 2074892 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g657450 | MPA12 | Metallophosphoesterase/metallo-dependent phosphatase; (1 of 1) 3.6.1.13//3.6.1.16//3.6.1.53 - ADP-ribose diphosphatase / ADPR-PPase // CDP-glycerol diphosphatase / CDP-glycerol pyrophosphatase // Mn(2+)-dependent ADP-ribose/CDP-alcohol diphosphatase / Mn(2+)-dependent ADP-ribose/CDP-alcohol pyrophosphatase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCGAGCAAGTAGATACCCGCGAGGAGCG |
| Internal bar code: | TCCTGGGGCATGGGTTCGGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 472 |
| LEAP-Seq percent confirming: | 14.3258 |
| LEAP-Seq n confirming: | 460 |
| LEAP-Seq n nonconfirming: | 2751 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTCTCCCAGGAACACAAC |
| Suggested primer 2: | CCCTCTGTAACATCCGCATT |