| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.156657 |
| Chromosome: | chromosome 4 |
| Location: | 2977029 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g224867 | (1 of 34) IPR001878 - Zinc finger, CCHC-type | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGATGCGTCAGTAAGCGCATGTGCCTTCG |
| Internal bar code: | TCCCTGAGGGGTAAGGCCGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 903 |
| LEAP-Seq percent confirming: | 99.8157 |
| LEAP-Seq n confirming: | 4332 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAAGAAGCAGAAGACGGAC |
| Suggested primer 2: | CCAGGAACTCACTAGCCTGC |