| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.156730 |
| Chromosome: | chromosome 1 |
| Location: | 6450926 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g045850 | (1 of 1) PF00665//PF07727 - Integrase core domain (rve) // Reverse transcriptase (RNA-dependent DNA polymerase) (RVT_2) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGTAGTATGGGGGACTATAGTGGAGTAA |
| Internal bar code: | GTCAGAGTGAATCTAGGGACTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 540 |
| LEAP-Seq percent confirming: | 97.3333 |
| LEAP-Seq n confirming: | 73 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTGTTCGACTTCACCAAG |
| Suggested primer 2: | GGAGAGGCGTAGCAGATGTC |