Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.156757 |
Chromosome: | chromosome 3 |
Location: | 2073886 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g156700 | FAP185,Nphp3 | (1 of 2) IPR011990//IPR013026//IPR019734 - Tetratricopeptide-like helical domain // Tetratricopeptide repeat-containing domain // Tetratricopeptide repeat; Flagellar Associated Protein 185 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGTATCCCCGTGCTTGGCGTCCCCTGAC |
Internal bar code: | GCAGGGTGGCTTTTGGTTTCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 678 |
LEAP-Seq percent confirming: | 98.8361 |
LEAP-Seq n confirming: | 2123 |
LEAP-Seq n nonconfirming: | 25 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGGGATTGTGGCTTTTGTT |
Suggested primer 2: | AATCAAGGGACCCCATTTTC |