Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.156807 |
Chromosome: | chromosome 7 |
Location: | 3622854 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g336950 | PHO2,PHOA2,PHOA | Starch phosphorylase 2, PhoA; (1 of 2) 2.4.1.1 - Glycogen phosphorylase / Polyphosphorylase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACACAGTCCCAAACGTGCACACCGTGCAC |
Internal bar code: | GAGTGCTTTACGATGGCAAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 688 |
LEAP-Seq percent confirming: | 99.8016 |
LEAP-Seq n confirming: | 1006 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTCCTCTACCAGGCACAAG |
Suggested primer 2: | CAAGGACTACTTCAAGCCGC |