| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.156979 |
| Chromosome: | chromosome 16 |
| Location: | 804820 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g647534 | NRX4 | Nucleoredoxin 4; (1 of 3) K17609 - nucleoredoxin [EC:1.8.1.8] (NXN) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTACAAGTCAAACCTTGAAGTCCTCGAA |
| Internal bar code: | TACTTCTGCAACAGGGCGGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 637 |
| LEAP-Seq percent confirming: | 99.5693 |
| LEAP-Seq n confirming: | 1387 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGATGCCCTGGATGTCCATA |
| Suggested primer 2: | CTCTGTCAGGGGGATGAAAA |