Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.157106 |
Chromosome: | chromosome 10 |
Location: | 1041452 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g425200 | (1 of 1) 1.8.3.5 - Prenylcysteine oxidase / Prenylcysteine lyase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCAAACTCCTGCACCCGACCGCCTTCCA |
Internal bar code: | CCGAGCTGGGCGAGACATAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 599 |
LEAP-Seq percent confirming: | 99.8227 |
LEAP-Seq n confirming: | 4505 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCTAGAAAGGCATGTGTGC |
Suggested primer 2: | ACTATCAGTTACGTGGGCGG |