Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.157157 |
Chromosome: | chromosome 12 |
Location: | 7576360 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g555250 | NUOB14 | NADH:ubiquinone oxidoreductase B14 subunit; (1 of 1) K03950 - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex subunit 6 (NDUFA6) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGCTTACAACGTCAGCCCGCAGAGCCCC |
Internal bar code: | TGGAGGAAACGGTTCCGTCCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 861 |
LEAP-Seq percent confirming: | 99.1717 |
LEAP-Seq n confirming: | 3472 |
LEAP-Seq n nonconfirming: | 29 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAGCAGCAGTACTTACCCA |
Suggested primer 2: | GGAGTGAGCTATCTGGCTGG |