| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.157159 |
| Chromosome: | chromosome 1 |
| Location: | 3065159 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g018900 | (1 of 1) K11971 - E3 ubiquitin-protein ligase RNF14 [EC:6.3.2.19] (RNF14, ARA54) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCAGTATTAGGGCAAAAGTCGCGGTCGA |
| Internal bar code: | CACTGCGAATGCGTTACGGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1067 |
| LEAP-Seq percent confirming: | 99.6194 |
| LEAP-Seq n confirming: | 1047 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGGACTAGCAGTGCAAATG |
| Suggested primer 2: | GACGTGGTTGCAGGTTAGGT |