Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.157237 |
Chromosome: | chromosome 11 |
Location: | 1519966 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467747 | (1 of 2) PF10173 - Mitochondrial K+-H+ exchange-related (Mit_KHE1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCGAGGACCCTATCGGCGCAGAGACAC |
Internal bar code: | ACCACACATCAGCGGTCTTCAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 754 |
LEAP-Seq percent confirming: | 99.8889 |
LEAP-Seq n confirming: | 2698 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGGATGCATTACAAAATCC |
Suggested primer 2: | TTCGTTCTTCGAGCAATGTG |