| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.157247 |
| Chromosome: | chromosome 14 |
| Location: | 977244 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g614000 | CGL17 | Conserved in the Green Lineage; (1 of 1) PTHR35699:SF1 - F2J10.10 PROTEIN | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAAGCACACGTGCACACGTCACATGTCAA |
| Internal bar code: | CCCTCCGGCGCCGCGGGAATATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 650 |
| LEAP-Seq percent confirming: | 99.6333 |
| LEAP-Seq n confirming: | 815 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTAGGAGAAGAGGTGGTGCG |
| Suggested primer 2: | CCGCAGTATTACGGTTTGGT |