| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.157259 |
| Chromosome: | chromosome 2 |
| Location: | 6730662 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g118250 | SWB1 | SWIB domain-containing protein; (1 of 1) K15223 - upstream activation factor subunit UAF30 (UAF30, SPP27) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGTGCTCAGGCCGGCGGGCCGGGCTCGT |
| Internal bar code: | GGTGATCCTATGGTATGGGAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 739 |
| LEAP-Seq percent confirming: | 67.7928 |
| LEAP-Seq n confirming: | 602 |
| LEAP-Seq n nonconfirming: | 286 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGGTGGTGAGGGTACTGC |
| Suggested primer 2: | ACCAGCCTACCCTGGTCTTT |