Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.157278 |
Chromosome: | chromosome 16 |
Location: | 2811043 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g663150 | (1 of 7) 2.8.1.1 - Thiosulfate sulfurtransferase / Thiosulfate thiotransferase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTACATAGTTCAAACGCCTCACCGCACCCT |
Internal bar code: | CTTCCTTCCTAGTAGCGCCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 161 |
LEAP-Seq percent confirming: | 98.8771 |
LEAP-Seq n confirming: | 1673 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTACCGCTCCTCTTACGGTG |
Suggested primer 2: | GACATGTGCTACGGTTGTGG |