Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.157435 |
Chromosome: | chromosome 17 |
Location: | 1212289 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g705000 | FAP223,CDPK1 | (1 of 1) PF00069//PF00168//PF13499//PF13833 - Protein kinase domain (Pkinase) // C2 domain (C2) // EF-hand domain pair (EF-hand_7) // EF-hand domain pair (EF-hand_8); Flagellar Associated Protein 223 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGAGCCTAACGCAGCGCGGCTGCACCGTA |
Internal bar code: | CTGGGATAATTAAAGAGGGGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 902 |
LEAP-Seq percent confirming: | 93.819 |
LEAP-Seq n confirming: | 850 |
LEAP-Seq n nonconfirming: | 56 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCACAGTCCGCATCTGTTC |
Suggested primer 2: | GACAATCAGCAGCTTGACCA |