| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.157449 |
| Chromosome: | chromosome 3 |
| Location: | 1216644 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g149650 | CCD1 | related to carotenoid 9%252C10-9'%252C10' cleavage dioxygenase; (1 of 1) K11159 - carotenoid cleavage dioxygenase (K11159) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGGCGTGTTTGTGCGTGTATACACTATG |
| Internal bar code: | CTGGTTACGGCGCGTGTGCGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 93 |
| LEAP-Seq percent confirming: | 92.0 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTCATGCTCACCGTCACTC |
| Suggested primer 2: | ACGAAGATGAGCAGGGAATG |