| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.157495 |
| Chromosome: | chromosome 13 |
| Location: | 4786205 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g605100 | PDE20 | (1 of 1) PF00233//PF01590 - 3'5'-cyclic nucleotide phosphodiesterase (PDEase_I) // GAF domain (GAF); 3'%252C5'-cyclic-nucleotide phosphodiesterase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACAGCCTTGCGCTAACGTGCACCGTCCC |
| Internal bar code: | GAGCCAGGAAATACTCCCAGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1001 |
| LEAP-Seq percent confirming: | 98.3307 |
| LEAP-Seq n confirming: | 2474 |
| LEAP-Seq n nonconfirming: | 42 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACATCAAAGTTGGCCTTGG |
| Suggested primer 2: | CATTGCTGTATGTTGGTGCC |