| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.157589 |
| Chromosome: | chromosome 3 |
| Location: | 2596952 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g160600 | (1 of 1) IPR000104//IPR000679//IPR013088 - Antifreeze protein, type I // Zinc finger, GATA-type // Zinc finger, NHR/GATA-type | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTCAGACATGTGTGAGTCTGGGTGCGTG |
| Internal bar code: | CTTTGCAAACCATCAAGTCGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 608 |
| LEAP-Seq percent confirming: | 99.2028 |
| LEAP-Seq n confirming: | 10329 |
| LEAP-Seq n nonconfirming: | 83 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAAAACGCTTTGAAGGAAG |
| Suggested primer 2: | AGCTCCAGTGCCAAGGTAGA |