| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.157696 |
| Chromosome: | chromosome 2 |
| Location: | 1761241 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g086550 | CGL122 | (1 of 4) K06941 - 23S rRNA (adenine2503-C2)-methyltransferase [EC:2.1.1.192] (rlmN); predicted Fe-S-cluster redox enzyme | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTTACGCGCCAGGGGAAGAGTACAACCG |
| Internal bar code: | TGTACTATCTTTCAGACGGTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 635 |
| LEAP-Seq percent confirming: | 99.435 |
| LEAP-Seq n confirming: | 4224 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGAGGTGCGATGTGTAACC |
| Suggested primer 2: | ACCGTAAATCCGTAATCCCC |