| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.157747 |
| Chromosome: | chromosome 10 |
| Location: | 2956251 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g440550 | (1 of 14) PF13540 - Regulator of chromosome condensation (RCC1) repeat (RCC1_2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGAGGAGATCTTCCGCCGCGTCAACTTC |
| Internal bar code: | GGTGTGGACGAGAGGGCCAGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 319 |
| LEAP-Seq percent confirming: | 99.7561 |
| LEAP-Seq n confirming: | 5316 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAGGACAGGTAGGACCAGG |
| Suggested primer 2: | GAGGAGTCCAAGCAGACCAC |