Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.157760 |
Chromosome: | chromosome 15 |
Location: | 314297 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre15.g635700 | MAPKKK12 | (1 of 40) PTHR23257//PTHR23257:SF513 - SERINE-THREONINE PROTEIN KINASE // SUBFAMILY NOT NAMED; Mitogen-Activated Protein Kinase Kinase Kinase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTATGGCCGCCACCTCCTTCAAAACCTA |
Internal bar code: | TCGGATAAGTCTGATCGAGATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 33 |
LEAP-Seq percent confirming: | 99.0991 |
LEAP-Seq n confirming: | 110 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGTGACGTCGTGTCACTGCT |
Suggested primer 2: | ATACACCTCTGGAACGCACC |