Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.157782 |
Chromosome: | chromosome 16 |
Location: | 4507658 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g667350 | CAV6 | (1 of 2) PF00520//PF08016//PF16905 - Ion transport protein (Ion_trans) // Polycystin cation channel (PKD_channel) // Voltage-dependent L-type calcium channel, IQ-associated (GPHH); Voltage-gated Ca2+ channel, alpha subunit | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGTGCTGCTGTGGGCCGAGTACGACGAC |
Internal bar code: | CTGAGGTAGGGCTTCTTTTCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 162 |
LEAP-Seq percent confirming: | 99.4609 |
LEAP-Seq n confirming: | 738 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGTCACTGGTCATGTCGCTG |
Suggested primer 2: | COULD_NOT_FIND_PRIMER |