| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.157783 |
| Chromosome: | chromosome 9 |
| Location: | 2069740 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g394050 | CPLD19 | Zinc finger family protein; (1 of 1) PTHR22883:SF91 - PROTEIN S-ACYLTRANSFERASE 12-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGCTCAGGATTGGAGAAAGCTACCCCT |
| Internal bar code: | GCGGCCCAGCGTCGCGGCCGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 152 |
| LEAP-Seq percent confirming: | 99.8634 |
| LEAP-Seq n confirming: | 3656 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTCTGTGTCTCCAACGCTC |
| Suggested primer 2: | ATACGTCCTCCCAAACCTCC |