Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.157784 |
Chromosome: | chromosome 7 |
Location: | 2609266 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g330150 | (1 of 7) IPR011335 - Restriction endonuclease type II-like | CDS/intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCGGGCTGCTGGCAGGGGTCGGCGCGTG |
Internal bar code: | GTCGAAAGGTGAGGCCCGGACGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1015 |
LEAP-Seq percent confirming: | 99.6631 |
LEAP-Seq n confirming: | 3550 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGTCGTGTCCCTCTTATGT |
Suggested primer 2: | GTCTACGCCAGATAGGCAGC |