| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.157784 |
| Chromosome: | chromosome 7 |
| Location: | 2609266 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g330150 | (1 of 7) IPR011335 - Restriction endonuclease type II-like | CDS/intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCGGGCTGCTGGCAGGGGTCGGCGCGTG |
| Internal bar code: | GTCGAAAGGTGAGGCCCGGACGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1015 |
| LEAP-Seq percent confirming: | 99.6631 |
| LEAP-Seq n confirming: | 3550 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTCGTGTCCCTCTTATGT |
| Suggested primer 2: | GTCTACGCCAGATAGGCAGC |